B1 Sequenzierung

Begonnen von Ahriman, 25.Feb.09 um 21:20 Uhr

⏪ vorheriges - nächstes ⏩

Rafaelissimo

wir arbeiten sehr langsam :D Der T&M ist sequenziert. Die anderen, unter anderem der B1 kommen als nächstes. Allerdings müssen die Pilze erst in einer Arbeit publiziert werden, das ist die Auflage der Fachstelle.
Liebe Grüsse aus der Schweiz,
Rafael

fred

Howdy,

The answer is in, but you're not going to like it.

According to Michele Rodda, they were only able to identify it up to genus level, and it seems to lie in Ceratobasidium (most people think it's Tulasnella).

Zitat
Hi Fred,
here is the sequence for B1:

ACCATATGACATGCTCTCCGAATGAATAGACGATTAGAACGCGGTTACTCCGCACTCCCGGCCCCTTTAGCACGTGTCCTCAGCGAGTGATACTTATCACGCCGGAGTGGAAACCGGAGCTCACTGGAGGATCCAGCTAATTTATTTAAGAGGAGCAGACGTGAATCTGCAGACCTCCAAGTCCAAAATAAATTCAATCGAATGAACNAAGAATTATTTTGATAATTTCATGATACTCNCAGGCATGCTCCANGGAATACCANGGAGCGCAAGGTGCGTTCNGATTCGATGATTCCTGAATTCTGCNATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAG

Using http://blast.ncbi.nlm.nih.gov/Blast.cgi as a
database to try to give a name to B1 I found out that the
only closely related species appear to be Ceratobasidium.
The colony morphology also reminds me of Ceratobasidium
since it is quite woolly. Usually Tulasnellas grow more
sparsely and more appressed to the medium.
I tried to germinate seeds of 5 orchid species with B1:
Anacamptis morio, laxiflora, Ophrys fuciflora, Orchis
Purpurea, Serapias vomeracea. None of these produced
protocorms, despite the fact that usually I can germinate
at least A. morio and S. vomeracea with a wide range of
fungal isolates, obtained from many different orchid
species.
I am soon publishing my results on germination of
mediterranean orchid species but I will not include B1
since the results were not good.

Sincerely, Michele

regards,
Fred

Niko

High Fred,
is it sure that he got the right fungus? O. morio is very easy to propagate with B1??

Ob das wiklich B1 ist der da sequenziert wurde? O. morio sollte doch sehr gut keimen mit B1  :ka

Viele Grüße
Niko

Charlemann

Nicht sollte, Orchis (Anacamptis) morio keimt sehr gut mit B1.

Berthold

Zitat von: Niko am 21.Jun.09 um 20:03 Uhr
High Fred,
is it sure that he got the right fungus? O. morio is very easy to propagate with B1??

Viele Grüße
Niko

Fred, maybe that Michele got the wrong individuum of B1. Not all B1-fungi are good germinators. You have to select the best germinator all the time.

My B1-fungi are best germinators for the Orchis laxiflora-group, the fastes of all orchids.

Nicht nur Orchis morio sondern auch Orchis longicornu keimt gut auf B1.

Greetings
Berthold
Weniger gelobt ist genug kritisiert (frei nach Peter Altmaier)

Claus

Hi Fred,

B1 doesn't grow woolly but grows very much appressed to the media, like Michele wrote for Tulasnella. From which source was the sample Michele wrote about? All the details about germinating seeds doesn't fit to B1.

Greetings
Claus
Wer Chemiker werden will, muss Chemie studieren; wer Jurist oder Arzt werden will, muss Jura oder Medizin studieren. Aber um Politiker zu werden, ist lediglich das Studium der eigenen Interessen notwendig. (Max O'Rell)

Volzotan

Von dem B1 habe ich Fred in 2008 was geschickt.

Gruß Volzotan

fred

Hi all,

I'm as puzzled as the rest of you.

Could anyone post a photograph of the B1 in an "old" culture where it developed well ?

regards,
Fred

Claus

Hi Fred,

that's not easy, because you can see the hyphae only under a certain angle of view. I have cultures of B1 and other fungus on active coal containing oat agar, where the contrast is a bit higher.

On the first picture you can see the hyphae on the glass wall of the vessel, the second picture shows a little bit also from the surface, but as I said, hyphae on surfaces are very difficult to show.

Greetings
Claus
Wer Chemiker werden will, muss Chemie studieren; wer Jurist oder Arzt werden will, muss Jura oder Medizin studieren. Aber um Politiker zu werden, ist lediglich das Studium der eigenen Interessen notwendig. (Max O'Rell)

fred

I think we can conclude that it's contamination. What I have labelled as B1 doesn't look like the picture, it forms small coils between the strands of hyphae:



Looks like Christian will have the honour of identifying it.

Volzotan

My B1 forms coils in older cultures, I think it is still uncontaminated.


fred

Roman, thanks for posting that picture. I recognise it immediately from my oldest culture. It was then 7+ months old, 20g/l which was too much but I kept it to see if anything funky would come out of it:



The brown colour is due to the red table and the flash, btw.

I received your parcel on March 20 2008 and took a sample from which my cultures are grown. According to my PMs I sent it to Michele the next day on the 21th. So the contamination must have happened by me during sampling, which is odd because it was done in a glovebox in an ISO 1 cleanroom.

winwen

Also ganz unerwartet ist das Ergebnis eigentlich nicht.

Den Papern von Hadley folgend zeigt T. calospora doch ganz deutlich eine Notwendigkeit für ganz bestimmte Nahrungszusätze (organisches Eiweiß, PABA, Thiamin) und eine deutliche Response, wenn es selbige auch bekommt (was bei Ceratobasidium nicht der Fall ist). T. calospora tut sich ferner teils wesentlich schwerer mit Zelluloseabbau als Ceratobasidium während von denen, die es versucht haben durchgehend bestätigt wird, dass B1 auf holzbasierten Substraten wesentlich wüchsiger ist wohingegen Hadley zur Beobachtung von Tulasnella auf Zellulose basierten Medien schreibt, dass sie sich dort schwächer wüchsig verhält. Leider sind das die einzigen Arbeiten, die ich zu dem Thema finden konnte, aber die machen den Outcome der Sequenzierung eher plausibel denn unglaubwürdiger.

fred

Sorry, forgot to mention it's OMA in the last picture.
Michele used malt-agar and in liquid culture to grow it before sequencing.


Claus

Well, the pictures from Roman, Fred and myself are typical for B1 of different ages. My culture was infected on June 10th, so it's still very fresh an doesn't show the typical sclerotia of older sammples.

The "spoiled" sammple looks like some of mine, when I didn't care enough about sterility. Since then I handle all that stuff only in a clean bench.
Wer Chemiker werden will, muss Chemie studieren; wer Jurist oder Arzt werden will, muss Jura oder Medizin studieren. Aber um Politiker zu werden, ist lediglich das Studium der eigenen Interessen notwendig. (Max O'Rell)